Read MR0000009123

Accession MR0000009123
Sequence 
uucggaccaggcuucauucc
Organism Arabidopsis thaliana
Stem-loop ID ath-MIR165a ath-MIR165b ath-MIR166a ath-MIR166b ath-MIR166c ath-MIR166d ath-MIR166e ath-MIR166f ath-MIR166g
Mature ID ath-miR165a ath-miR165b ath-miR166a ath-miR166b ath-miR166c ath-miR166d ath-miR166e ath-miR166f ath-miR166g

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000003 1 whole body GEO : GSM253622 [ Mi S et al.]
ER0000000006 5 whole body GEO : GSM253625 [ Mi S et al.]

References

1
PMID : 18342361
  • "Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5' terminal nucleotide"
    • Mi S, Cai T, Hu Y, Chen Y, Hodges E, Ni F, Wu L, Li S, Zhou H, Long C, Chen S, Hannon GJ, Qi Y. Cell. 133:116-127(2008).