Read MR0000008710

Accession MR0000008710
Sequence 
gagaaucuugaugaugcugc
Organism Arabidopsis thaliana
Stem-loop ID ath-MIR172a ath-MIR172b ath-MIR172c ath-MIR172d ath-MIR172e
Mature ID ath-miR172a ath-miR172b-3p ath-miR172c ath-miR172d ath-miR172e

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000003 1 whole body GEO : GSM253622 [ Mi S et al.]
ER0000000005 2 whole body GEO : GSM253624 [ Mi S et al.]

References

1
PMID : 18342361
  • "Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5' terminal nucleotide"
    • Mi S, Cai T, Hu Y, Chen Y, Hodges E, Ni F, Wu L, Li S, Zhou H, Long C, Chen S, Hannon GJ, Qi Y. Cell. 133:116-127(2008).