Read MR0000007648

Accession MR0000007648
Sequence
uuaaggcacgcggugaaugccaa
Organism Homo sapiens
Stem-loop ID hsa-mir-124-1 hsa-mir-124-2 hsa-mir-124-3
Mature ID hsa-miR-124-3p hsa-miR-124-3p hsa-miR-124-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000002 1 embryonic stem cell GEO : GSM541797 [ Bar M et al.]

References

1
PMID : 18583537
  • "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries"
  • Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).