Read MR0000002512

Accession MR0000002512
Sequence 
uggcucaguucagcaggaac
Organism Homo sapiens
Stem-loop ID hsa-mir-24-1 hsa-mir-24-2
Mature ID hsa-miR-24-3p hsa-miR-24-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000001 1 embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 449 embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 123 melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 24 melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 98 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 14 melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 62 melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 335 melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 43 melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 146 melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 153 melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 192 melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 57 melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 103 melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 9 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 6 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000266 19 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 2 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]

References

1
PMID : 18583537
  • "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries"
    • Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
    2
    PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
    • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
    3
    PMID : 19144710
  • "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
    • Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).