Read MR0000001806

Accession MR0000001806
Sequence 
ugagaaccacgucugcucugagc
Organism Homo sapiens
Stem-loop ID hsa-mir-589
Mature ID hsa-miR-589-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000001 2 embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 1 embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 22 melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 4 melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 2 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000107 4 melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 18 melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 2 melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 48 melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 2 melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 4 melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 7 melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 9 melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]

References

1
PMID : 18583537
  • "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries"
    • Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
    2
    PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
    • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).