Read MR0000000735

AccessionMR0000000735
Sequence
caaagugcucauagugcaggu
OrganismHomo sapiens
Stem-loop ID hsa-mir-20b

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueLinkCommentReference
ER00000000016Embryonic stem cellGEO : GSM541796 [ Bar M et al.]
ER00000000022Embryonic stem cellGEO : GSM541797 [ Bar M et al.]
ER00000001062MelanomaGEO : GSM458538Cell line: Secondary acral melanoma[ Stark MS et al.]
ER000000011112MelanomaGEO : GSM458543Cell line: Secondary cutaneous melanoma[ Stark MS et al.]
ER00000001122MelanomaGEO : GSM458544Cell line: Secondary cutaneous melanoma[ Stark MS et al.]
ER00000001471Uterine cervixGEO : GSM532883 [ Witten D et al.]
ER00000001491Uterine cervixGEO : GSM532885 [ Witten D et al.]
ER00000001551Uterine cervixGEO : GSM532891 [ Witten D et al.]
ER00000001594Uterine cervixGEO : GSM532895 [ Witten D et al.]
ER00000001611Uterine cervixGEO : GSM532897 [ Witten D et al.]
ER00000001632Uterine cervixGEO : GSM532899 [ Witten D et al.]
ER00000001642Squamous cellGEO : GSM532900 [ Witten D et al.]
ER00000001651Uterine cervixGEO : GSM532901 [ Witten D et al.]
ER00000001672Uterine cervixGEO : GSM532903 [ Witten D et al.]
ER00000001732Uterine cervixGEO : GSM532909 [ Witten D et al.]
ER00000001751Uterine cervixGEO : GSM532911 [ Witten D et al.]
ER00000001772Uterine cervixGEO : GSM532913 [ Witten D et al.]
ER00000001793Uterine cervixGEO : GSM532915 [ Witten D et al.]
ER00000001801Squamous cellGEO : GSM532916 [ Witten D et al.]
ER00000002641Undifferentiated NPCGEO : GSM368181 [ Zhu JY et al.]
ER00000002776TonsilGEO : GSM569185Cell type: Centroblast; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting[ Kuchen S et al.]
ER00000002784TonsilGEO : GSM569186Cell type: Centrocyte; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting[ Kuchen S et al.]
ER00000002795TonsilGEO : GSM569187Cell type: Pre-germinal center B cell; Gender: Female; Age: 3 years; Isolation: Fluorescence activated cell sorting[ Kuchen S et al.]
ER00000002812TonsilGEO : GSM569189Cell type: Naive B cell; Gender: Female; Age: 5 years; Isolation: Fluorescence activated cell sorting[ Kuchen S et al.]

References

1
PMID : 18583537
  • "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries"
  • Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
    2
    PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
  • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
    3
    4
    PMID : 19144710
  • "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
  • Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
    5
    PMID : 20605486
  • "Regulation of microRNA expression and abundance during lymphopoiesis"
  • Kuchen S, Resch W, Yamane A, Kuo N, Li Z, Chakraborty T, Wei L, Laurence A, Yasuda T, Peng S, Hu-Li J, Lu K, Dubois W, Kitamura Y, Charles N, Sun HW, Muljo S, Schwartzberg PL, Paul WE, O'Shea J, Rajewsky K, Casellas R Immunity. 32:828-839(2010).