Read MR0000000735

Accession MR0000000735
Sequence
caaagugcucauagugcaggu
Organism Homo sapiens
Stem-loop ID hsa-mir-20b

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000001 6 embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 2 embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000106 2 melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000111 12 melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 2 melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000147 1 uterine cervix GEO : GSM532883 [ Witten D et al.]
ER0000000149 1 uterine cervix GEO : GSM532885 [ Witten D et al.]
ER0000000155 1 uterine cervix GEO : GSM532891 [ Witten D et al.]
ER0000000159 4 uterine cervix GEO : GSM532895 [ Witten D et al.]
ER0000000161 1 uterine cervix GEO : GSM532897 [ Witten D et al.]
ER0000000163 2 uterine cervix GEO : GSM532899 [ Witten D et al.]
ER0000000164 2 squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 1 uterine cervix GEO : GSM532901 [ Witten D et al.]
ER0000000167 2 uterine cervix GEO : GSM532903 [ Witten D et al.]
ER0000000173 2 uterine cervix GEO : GSM532909 [ Witten D et al.]
ER0000000175 1 uterine cervix GEO : GSM532911 [ Witten D et al.]
ER0000000177 2 uterine cervix GEO : GSM532913 [ Witten D et al.]
ER0000000179 3 uterine cervix GEO : GSM532915 [ Witten D et al.]
ER0000000180 1 squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000264 1 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000277 6 tonsil GEO : GSM569185 cell type: centroblast, gender: female, age: 3 years, isolation: fluorescence activated cell sorting [ Kuchen S et al.]
ER0000000278 4 tonsil GEO : GSM569186 cell type: centrocyte, gender: female, age: 3 years, isolation: fluorescence activated cell sorting [ Kuchen S et al.]
ER0000000279 5 tonsil GEO : GSM569187 cell type: pre-germinal center B cell, gender: female, age: 3 years, isolation: fluorescence activated cell sorting [ Kuchen S et al.]
ER0000000281 2 tonsil GEO : GSM569189 cell type: naive B cell, gender: female, age: 5 years, isolation: fluorescence activated cell sorting [ Kuchen S et al.]

References

1
PMID : 18583537
  • "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries"
  • Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
    2
    PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
  • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
    3
    4
    PMID : 19144710
  • "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
  • Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
    5
    PMID : 20605486
  • "Regulation of microRNA expression and abundance during lymphopoiesis"
  • Kuchen S, Resch W, Yamane A, Kuo N, Li Z, Chakraborty T, Wei L, Laurence A, Yasuda T, Peng S, Hu-Li J, Lu K, Dubois W, Kitamura Y, Charles N, Sun HW, Muljo S, Schwartzberg PL, Paul WE, O'Shea J, Rajewsky K, Casellas R Immunity. 32:828-839(2010).