Read MR0000000735

AccessionMR0000000735
Sequence
acguauacugaauguauccuga
OrganismDrosophila melanogaster
Stem-loop ID dme-mir-iab-4

Experiment

Click the column headings to sort the results table, or restore to the original order.

AccessionRead countTissueSRA accessionCommentReference
ER00000000105headSRR068998 1946
ER00000000131Kc cellSRR069831 1946
ER000000001459imaginal discSRR069832 1946
ER00000000151headSRR069835 1946
ER000000001610whole bodySRR069836 1946
ER00000000178whole bodySRR069837 1946
ER00000000212253embryoSRR069838 1946
ER00000000223304embryoSRR069839 1946
ER000000002390embryoSRR069840 1946
ER0000000080110whole bodySRR0136012-4 day old pupae
ER000000008211whole bodySRR0136032-4 day old pupae
ER00000000835headSRR013604adult female head
ER0000000089142embryoSRR01436712-24hr embryo
ER000000009964imaginal discSRR016853imaginal disc/brain
ER000000010017whole bodySRR018039female body
ER0000000101110whole bodySRR016854male body