Stem-loop sequence hsa-mir-941-1

Accession MI0005763
Symbol HGNC:MIR941-1
Description Homo sapiens miR-941-1 stem-loop
Gene family MIPF0000387; mir-941
Stem-loop
   u u  -        c  g    c   aca   -  a g 
5'  g gg acaugugc ca ggcc ggg   gcg cc c g
    | || |||||||| || |||| |||   ||| || |  
3'  c cc uguacacg gu ucgg ccc   cgc gg g a
   a -  g        u  g    -   --a   a  a a 
Get sequence
Deep sequencing
2653 reads, 601 reads per million, 59 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr20: 63919449-63919520 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-941-1
hsa-mir-941-1 chr20: 63919449-63919520 [+]
hsa-mir-941-2 chr20: 63919505-63919576 [+]
hsa-mir-941-3 chr20: 63919561-63919632 [+]
hsa-mir-941-4 chr20: 63919756-63919827 [+]
hsa-mir-941-5 chr20: 63919868-63919939 [+]
Database links

Mature sequence hsa-miR-941

Accession MIMAT0004984
Sequence

47 - 

cacccggcugugugcacaugugc

 - 69

Get sequence
Deep sequencing 2496 reads, 48 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
2
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).