Stem-loop sequence hsa-mir-4748

Accession

MI0017387

Description

Homo sapiens miR-4748 stem-loop

Stem-loop

u    -------   -  a  u     g   a      gg g  a 
 ggcu       ggc ug gg uuggg agg uuugcu  u cu g
 ||||       ||| || || ||||| ||| ||||||  | ||  
 ccga       ccg ac cc aaccc ucc agacga  a ga a
a    caucauc   c  -  c     a   c      -a g  g 

Deep sequencing

7 reads, 5 experiments

Genome context

• Coordinates (GRCh37.p5): chr19: 10890930-10891011 [+]
• Overlapping transcripts:

  sense

  ENST00000389252 ; DNM2-204; intron 5

  ENST00000408974 ; DNM2-206; intron 5

  ENST00000355667 ; DNM2-202; intron 5

  ENST00000359692 ; DNM2-203; intron 5

  ENST00000389253 ; DNM2-205; intron 5

  ENST00000314646 ; DNM2-201; intron 5

  ENST00000389252 ; DNM2-204; intron 5

  ENST00000408974 ; DNM2-206; intron 5

  ENST00000355667 ; DNM2-202; intron 5

  ENST00000359692 ; DNM2-203; intron 5

  ENST00000389253 ; DNM2-205; intron 5

  ENST00000314646 ; DNM2-201; intron 5

  ENST00000408974 ; DNM2-205; intron 5

  ENST00000355667 ; DNM2-202; intron 5

  ENST00000359692 ; DNM2-203; intron 5

  ENST00000389253 ; DNM2-204; intron 5

  ENST00000314646 ; DNM2-201; intron 5

Database links

• ENTREZGENE: 100616425;MIR4748

Mature sequence hsa-miR-4748

• Accession: MIMAT0019884
• Sequence: 10 - gagguuuggggaggauuugcu - 30
• Deep sequencing: 7 reads, 5 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-4748
  • MIRDB:hsa-miR-4748
  • TARGETMINER:hsa-miR-4748

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).