Stem-loop sequence xla-mir-20

Accession

MI0001453

Description

Xenopus laevis miR-20 stem-loop

Gene family

MIPF0000001; mir-17

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Stem-loop

-     -ucca           g     g   ---u  u 
 gcagu     aagugcucaua ugcag uag    ug a
 |||||     ||||||||||| ||||| |||    ||  
 cguca     uucacggguau auguc auc    ac u
u     ugaca           a     -   uugu  u 

Mature sequence xla-miR-20

• Accession: MIMAT0001348
• Sequence: 8 - caaagugcucauagugcagguag - 30
• Evidence: experimental; cloned [1]
• Predicted targets:
  • TARGETSCAN-VERT:xla-miR-20

References

1. PMID:15642338 "Stage-specific expression of microRNAs during Xenopus development" Watanabe T, Takeda A, Mise K, Okuno T, Suzuki T, Minami N, Imai H FEBS Lett. 579:318-324(2005).