|
miRBase |
|
Stem-loop sequence ppt-MIR533a |
|||||
| Accession | MI0003500 | ||||
| Previous IDs | ppt-MIR533 | ||||
| Description | Physcomitrella patens miR533a stem-loop | ||||
| Gene family | MIPF0000356; MIR533 | ||||
| Stem-loop |
gc ac aga cuu u cc auggggagcug caggcugugaggg ggagc guugg g ggcu u ||||||||||| ||||||||||||| ||||| ||||| | |||| ugccucucgac gucugacacuccu cuucg cgacc c ccgg u ac -c --a ucc - ug |
||||
| Deep sequencing |
| ||||
| Comments |
Arazi et al. identified a mature miRNA from the 5' arm of this precursor, and called it miR533 [1]. Axtell et al. show by deep sequencing that the 3' product is the predominant one [3]. The 5' miRNA is renamed miR533* here. |
||||
| Genome context |
|
||||
Mature sequence ppt-miR533a-5p |
|
| Accession | MIMAT0003137 |
| Previous IDs | ppt-miR533;ppt-miR533a;ppt-miR533a* |
| Sequence |
6 - gagcuggccaggcugugaggg - 26 |
| Deep sequencing | 311 reads, 3 experiments |
| Evidence | experimental; cloned [1] |
Mature sequence ppt-miR533a-3p |
|
| Accession | MIMAT0004783 |
| Previous IDs | ppt-miR533a |
| Sequence |
79 - cucacagucugcacagcucuc - 99 |
| Deep sequencing | 6933 reads, 3 experiments |
| Evidence | experimental; 454 [3] |
References |
|
| 1 |
PMID:16146523
"Cloning and characterization of micro-RNAs from moss"
Plant J. 43:837-848(2005).
|
| 2 |
PMID:17359535
"Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution"
BMC Plant Biol. 7:13(2007).
|
| 3 |
PMID:17601824
"Common functions for diverse small RNAs of land plants"
Plant Cell. 19:1750-1769(2007).
|