Stem-loop sequence osa-MIR166i

Accession

MI0001144

Description

Oryza sativa miR166i stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

agaua     uu      c          a            -------      -g  -      --a       u 
     ggugu  ggaaug aguuugaucc agaucugccuau       auauau  gu guguau   ucauauc u
     |||||  |||||| |||||||||| ||||||||||||       ||||||  || ||||||   |||||||  
     ccaca  ccuuac ucggacuagg ucuagauggaug       ugugug  ca cguaua   gguauag g
cauaa     cu      u          c            gggacag      ga  a      ggg       u 

Deep sequencing

5460 reads, 4 experiments

Comments

This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors.

Genome context

• Coordinates (MSU7): Chr3: 25294953-25295097 [+]
• Overlapping transcripts:

  intergenic

Mature sequence osa-miR166i-5p

• Accession: MIMAT0022883
• Sequence: 15 - aaugcaguuugauccaagauc - 35
• Evidence: experimental; Solexa [2]

Mature sequence osa-miR166i-3p

• Accession: MIMAT0001074
• Previous IDs: osa-miR166i
• Sequence: 115 - ucggaucaggcuucauuccuc - 135
• Deep sequencing: 5437 reads, 4 experiments
• Evidence: by similarity; MI0000201

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).