|
miRBase |
|
Stem-loop sequence osa-MIR1432 |
|||
| Accession | MI0006972 | ||
| Description | Oryza sativa miR1432 stem-loop | ||
| Gene family | MIPF0000638; MIR1318 | ||
| Stem-loop |
a a ga -c ------ cu c ccugug ucagg gagaugacacc caucg cgga auucguu uggu u |||||| ||||| ||||||||||| ||||| |||| ||||||| |||| u ggauac agucc cucuacugugg guagu gccu uaaguag accg g a c ac uu gguagu -u u |
||
| Deep sequencing |
| ||
Mature sequence osa-miR1432 |
|
| Accession | MIMAT0005966 |
| Sequence |
7 - aucaggagagaugacaccgac - 27 |
| Deep sequencing | 1964 reads, 4 experiments |
| Evidence | experimental; MPSS [1], Northern [1], cloned [2] |
References |
|
| 1 |
PMID:18353984
"Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)"
Proc Natl Acad Sci U S A. 105:4951-4956(2008).
|
| 2 |
PMID:18312648
"Identification of novel and candidate miRNAs in rice by high throughput sequencing"
BMC Plant Biol. 8:25(2008).
|