Stem-loop sequence mmu-mir-98

Accession MI0000586
Symbol MGI:Mir98
Description Mus musculus miR-98 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   -      ug   u                 u    ---------      aggg 
 ugc acaugc  ggg gagguaguaaguuguau guug         uggggu    a
 ||| ||||||  ||| ||||||||||||||||| ||||         ||||||    u
 acg ugugug  ucc uuucaucauucaacaua caau         accccg    u
u   g      gu   -                 u    agaagaaug      gauu 
Get sequence
Deep sequencing
29159984 reads, 97 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 151913214-151913321 [+]
sense
OTTMUST00000046396 ; Huwe1-001; intron 57
OTTMUST00000046226 ; Huwe1-002; intron 59
ENSMUST00000112622 ; Huwe1-001; intron 57
ENSMUST00000026292 ; Huwe1-002; intron 59
Clustered miRNAs
< 10kb from mmu-mir-98
mmu-let-7f-2 chrX: 151912346-151912428 [+]
mmu-mir-98 chrX: 151913214-151913321 [+]
Database links

Mature sequence mmu-miR-98-5p

Accession MIMAT0000545
Previous IDs mmu-miR-98
Sequence

16 - 

ugagguaguaaguuguauuguu

 - 37

Get sequence
Deep sequencing 28858951 reads, 82 experiments
Evidence experimental; cloned [1], Solexa [2,4]
Predicted targets

Mature sequence mmu-miR-98-3p

Accession MIMAT0017023
Previous IDs mmu-miR-98*
Sequence

74 - 

cuauacaacuuacuacuuuccu

 - 95

Get sequence
Deep sequencing 727 reads, 58 experiments
Evidence experimental; 454 [3], Solexa [4]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).