Stem-loop sequence mmu-mir-499

Accession MI0004676
Symbol MGI:Mir499
Description Mus musculus miR-499 stem-loop
Gene family MIPF0000173; mir-499
Stem-loop 
gggu       u  ua        a          ---  uc 
    gggcagc gu  agacuugc gugauguuua   gc  c
    ||||||| ||  |||||||| ||||||||||   ||   
    uccgucg cg  ucugaacg cacuacaagu   cg  u
----       u  ug        a          gua  uc
Get sequence
Deep sequencing
reads, experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 155622880-155622958 [+]
sense
OTTMUST00000038477 ; Myh7b-001; intron 19
ENSMUST00000092995 ; Myh7b-001; intron 19
Database links

Mature sequence mmu-miR-499-5p

Accession MIMAT0003482
Previous IDs mmu-miR-499
Sequence

14 -  

uuaagacuugcagugauguuu

 - 34

Get sequence
Evidence experimental; MPSS [1], cloned [2], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-499-3p

Accession MIMAT0017254
Previous IDs mmu-miR-499*
Sequence

50 -  

gaacaucacagcaagucugugcu

 - 72

Get sequence
Evidence experimental; Solexa [4]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).