|
miRBase |
|
Stem-loop sequence mmu-mir-431 |
|||||
| Accession | MI0001524 | ||||
| Symbol | MGI:Mir431 | ||||
| Description | Mus musculus miR-431 stem-loop | ||||
| Gene family | MIPF0000142; mir-431 | ||||
| Stem-loop |
----- c u c u a ---- aca cguc ugcgagg gucuugcagg cg c ugcag gcc c |||| ||||||| |||||||||| || | ||||| ||| gcag acgcucu cgggacguuc gc g acguu ugg u cuaca a u u u g gcaa cag |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-431-5p |
|
| Accession | MIMAT0001418 |
| Previous IDs | mmu-miR-431 |
| Sequence |
13 - ugucuugcaggccgucaugca - 33 |
| Deep sequencing | 89447 reads, 47 experiments |
| Evidence | experimental; PCR [1], cloned [2-3], insitu [2], Northern [2], Solexa [4-5] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence mmu-miR-431-3p |
|
| Accession | MIMAT0004753 |
| Previous IDs | mmu-miR-431* |
| Sequence |
56 - caggucgucuugcagggcuucu - 77 |
| Deep sequencing | 4485 reads, 38 experiments |
| Evidence | experimental; cloned [3], Solexa [4-5] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15854907
"RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus"
Curr Biol. 15:743-749(2005).
|
| 2 |
PMID:16566924
"Identification of new central nervous system specific mouse microRNAs"
FEBS Lett. 580:2195-2200(2006).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|