Stem-loop sequence mmu-mir-375

Accession MI0000792
Symbol MGI:Mir375
Description Mus musculus miR-375 stem-loop
Gene family MIPF0000114; mir-375
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-375. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-375 microRNA is a short RNA molecule. MicroRNAs (miRNAs) are small (18-25 nucleotides), non-coding RNAs that regulate genes post-transcriptionally by inhibiting translation and/or causing mRNA degradation. miR-375 is found on human chromosome 2 in between the CRYBA2 and CCDC108 genes. miR-375 is specifically expressed in the pancreatic islets and brain. miR-375 was one of the first miRNAs identified in the pancreas (Poy et al, 2004), and remains one of the best characterised in terms of function. It is expressed in the pancreas and pituitary gland, organs linked by their role in hormone secretion, and expression levels increase during pancreas organogenesis. Loss-of-function studies showed that miR-375 is essential for β-cell formation in zebrafish (Kloosterman et al, 2007). miR-375 knockout mice have decreased numbers of β-cells and increased numbers of α-cells. The increase in glucagon levels, combined with the reduction in insulin levels, results in hyperglycaemia. This shows the importance of miR-375 in the establishment of normal pancreatic cell mass through the targeting of a group of genes which control cellular growth and proliferation in the developing pancreas (Poy et al, 2009). Further evidence for the involvement of miR-375 in pancreas development includes the fact that its expression is regulated by several transcription factors important in pancreatic development and function, including HNF6, INSM1, NGN3, NEUROD1, and PDX-1 (Keller et al, 2007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c  -    a      ccu  c     c  gac 
 cc cgcg cgagcc   cg acaaa cg   c
 || |||| ||||||   || ||||| ||    
 gg gugc gcucgg   gc uguuu gc   u
c  a    -      cuu  u     u  gag 
Get sequence
Deep sequencing
436534 reads, 90 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 74900658-74900721 [-]
sense
ENSMUST00000083682 ; Mir375-201; exon 1
Database links

Mature sequence mmu-miR-375-5p

Accession MIMAT0017078
Previous IDs mmu-miR-375*
Sequence

5 - 

gcgacgagccccucgcacaaac

 - 26

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence experimental; Solexa [4]
Predicted targets

Mature sequence mmu-miR-375-3p

Accession MIMAT0000739
Previous IDs mmu-miR-375
Sequence

40 - 

uuuguucguucggcucgcguga

 - 61

Get sequence
Deep sequencing 236253 reads, 76 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).