|
miRBase |
|
Stem-loop sequence mmu-mir-337 |
|||||
| Accession | MI0000615 | ||||
| Symbol | MGI:Mir337 | ||||
| Description | Mus musculus miR-337 stem-loop | ||||
| Gene family | MIPF0000195; mir-337 | ||||
| Stem-loop |
caguguagugagaa uu - c c u ca g ggggggugg gaa ggcgucaug aggaguuga ug c | ||||||||| ||| ||||||||| ||||||||| || c ucccccacu cuu ccguaguau uccucgacu ac a -------------a -u u u a u cg |
||||
| Deep sequencing |
| ||||
| Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000614 ). Seitz et al. later predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the hairpin, named here miR-337-5p and miR-337-3p [3]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-337-5p |
|
| Accession | MIMAT0004644 |
| Sequence |
27 - gaacggcgucaugcaggaguu - 47 |
| Deep sequencing | 18105 reads, 67 experiments |
| Evidence | experimental; cloned [3], Solexa [4-5] |
| Predicted targets |
|
Mature sequence mmu-miR-337-3p |
|
| Accession | MIMAT0000578 |
| Previous IDs | mmu-miR-337 |
| Sequence |
61 - uucagcuccuauaugaugccu - 81 |
| Deep sequencing | 10807 reads, 47 experiments |
| Evidence | experimental; PCR [2], cloned [3], Solexa [4-5] |
| Predicted targets |
|
References |
|
| 1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
| 2 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|