|
miRBase |
|
Stem-loop sequence mmu-mir-329 |
|||||
| Accession | MI0000605 | ||||
| Symbol | MGI:Mir329 | ||||
| Description | Mus musculus miR-329 stem-loop | ||||
| Gene family | MIPF0000110; mir-329 | ||||
| Stem-loop |
uguucgcuuc c uu cuc - g ugguac ggaagagagguu cugggu uguuuc uuu a |||||| |||||||||||| |||||| |||||| ||| u acuaug cuuuuuuuccaa gaccca acaaag aag g -----ccuaa a uc --c u a |
||||
| Deep sequencing |
| ||||
| Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000604 ). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. verified expression by cloining [3]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-329-5p |
|
| Accession | MIMAT0017032 |
| Previous IDs | mmu-miR-329* |
| Sequence |
23 - agagguuuucugggucucuguu - 44 |
| Deep sequencing | 8017 reads, 57 experiments |
| Evidence | experimental; 454 [5], Solexa [6] |
| Predicted targets |
|
Mature sequence mmu-miR-329-3p |
|
| Accession | MIMAT0000567 |
| Previous IDs | mmu-miR-329 |
| Sequence |
61 - aacacacccagcuaaccuuuuu - 82 |
| Deep sequencing | 4046 reads, 37 experiments |
| Evidence | experimental; cloned [3], Solexa [4,6] |
| Predicted targets |
|
References |
|
| 1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
| 2 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|