Stem-loop sequence mmu-mir-324

Accession MI0000595
Symbol MGI:Mir324
Description Mus musculus miR-324 stem-loop
Gene family MIPF0000165; mir-324
Stem-loop
aacu      gc     c   u c   a     u   u  aaag 
    gacuau  cuccu gca c ccu gggca ugg gu    c
    ||||||  ||||| ||| | ||| ||||| ||| ||     
    cugaug  ggggg cgu g gga cccgu acc ca    u
cagu      uu     u   c u   c     c   -  gagg 
Get sequence
Deep sequencing
64729 reads, 97 experiments
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000594 ) - expression of miRNAs from both arms was later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The predominant miR-324-3p clone has a 3' terminal U residue, which is incompatible with the genome sequence [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 70012043-70012131 [+]
sense
OTTMUST00000098279 ; Dvl2-006; exon 16
ENSMUST00000102575 ; Dvl2-006; exon 16
antisense
OTTMUST00000013536 ; Acadvl-006; intron 2
OTTMUST00000013532 ; Acadvl-002; intron 10
OTTMUST00000013531 ; Acadvl-001; intron 11
ENSMUST00000146129 ; Acadvl-006; intron 2
ENSMUST00000018718 ; Acadvl-002; intron 10
ENSMUST00000102574 ; Acadvl-001; intron 11
Database links

Mature sequence mmu-miR-324-5p

Accession MIMAT0000555
Sequence

18 - 

cgcauccccuagggcauuggugu

 - 40

Get sequence
Deep sequencing 18791 reads, 81 experiments
Evidence experimental; cloned [2-3], Solexa [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-324-3p

Accession MIMAT0000556
Sequence

53 - 

ccacugccccaggugcugcu

 - 72

Get sequence
Deep sequencing 10624 reads, 81 experiments
Evidence experimental; cloned [2], Solexa [4-5]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).