Stem-loop sequence mmu-mir-324

Accession

MI0000595

Symbol

MGI:Mir324

Description

Mus musculus miR-324 stem-loop

Gene family

MIPF0000165; mir-324

Stem-loop

aacu      gc     c   u c   a     u   u  aaag 
    gacuau  cuccu gca c ccu gggca ugg gu    c
    ||||||  ||||| ||| | ||| ||||| ||| ||     
    cugaug  ggggg cgu g gga cccgu acc ca    u
cagu      uu     u   c u   c     c   -  gagg 

Deep sequencing

64729 reads, 97 experiments

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000594 ) - expression of miRNAs from both arms was later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The predominant miR-324-3p clone has a 3' terminal U residue, which is incompatible with the genome sequence [3].

Genome context

• Coordinates (GRCm38): chr11: 70012043-70012131 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000098279 ; Dvl2-006; exon 16

  ENSMUST00000102575 ; Dvl2-006; exon 16

  antisense

  OTTMUST00000013536 ; Acadvl-006; intron 2

  OTTMUST00000013532 ; Acadvl-002; intron 10

  OTTMUST00000013531 ; Acadvl-001; intron 11

  ENSMUST00000146129 ; Acadvl-006; intron 2

  ENSMUST00000018718 ; Acadvl-002; intron 10

  ENSMUST00000102574 ; Acadvl-001; intron 11

Database links

• ENTREZGENE: 723896;Mir324
• MGI: 3619335;Mir324

Mature sequence mmu-miR-324-5p

• Accession: MIMAT0000555
• Sequence: 18 - cgcauccccuagggcauuggugu - 40
• Deep sequencing: 18791 reads, 81 experiments
• Evidence: experimental; cloned [2-3], Solexa [4-5]
• Validated targets:
  • MIRTARBASE:mmu-miR-324-5p
  • TARBASE:mmu-miR-324-5p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-324-5p
  • MICRORNA.ORG:mmu-miR-324-5p
  • MIRDB:mmu-miR-324-5p
  • RNA22-MMU:mmu-miR-324-5p
  • TARGETSCAN-VERT:mmu-miR-324-5p

Mature sequence mmu-miR-324-3p

• Accession: MIMAT0000556
• Sequence: 53 - ccacugccccaggugcugcu - 72
• Deep sequencing: 10624 reads, 81 experiments
• Evidence: experimental; cloned [2], Solexa [4-5]
• Validated targets:
  • TARBASE:mmu-miR-324-3p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-324-3p
  • MICRORNA.ORG:mmu-miR-324-3p
  • MIRDB:mmu-miR-324-3p
  • RNA22-MMU:mmu-miR-324-3p
  • TARGETSCAN-VERT:mmu-miR-324-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).