Stem-loop sequence mmu-mir-290

Accession MI0000388
Symbol MGI:Mir290
Description Mus musculus miR-290 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop 
    u  u    ua  -c      u  g          uuu 
cuca cu gcgg  cu  aaacua gg ggcacuuuuu   u
|||| || ||||  ||  |||||| || ||||||||||   u
gagu gg cgcc  ga  uuugau cc ccgugaaaaa   c
    u  c    cc  au      -  g          uuu
Get sequence
Deep sequencing
46083 reads, 30 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr7: 3218626-3218708 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-290
mmu-mir-290 chr7: 3218626-3218708 [+]
mmu-mir-291a chr7: 3218919-3219000 [+]
mmu-mir-292 chr7: 3219189-3219270 [+]
mmu-mir-291b chr7: 3219482-3219560 [+]
mmu-mir-293 chr7: 3220343-3220422 [+]
mmu-mir-294 chr7: 3220641-3220724 [+]
mmu-mir-295 chr7: 3220773-3220841 [+]
Database links

Mature sequence mmu-miR-290-5p

Accession MIMAT0000366
Previous IDs mmu-miR-290
Sequence

14 -  

acucaaacuaugggggcacuuu

 - 35

Get sequence
Deep sequencing 45596 reads, 19 experiments
Evidence experimental; cloned [1-2], Northern [1], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-290-3p

Accession MIMAT0004572
Sequence

49 -  

aaagugccgccuaguuuuaagccc

 - 72

Get sequence
Deep sequencing 139 reads, 4 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Validated targets
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).