Stem-loop sequence mmu-mir-125b-2

Accession MI0000152
Previous IDs mmu-mir-125b
Symbol MGI:Mir125b-2
Description Mus musculus miR-125b-2 stem-loop
Gene family MIPF0000017; mir-125
Stem-loop
      uc  ug   c   a        -gg   u 
gccuag  cc  aga ccu acuuguga   uau u
||||||  ||  ||| ||| ||||||||   |||  
cggauc  gg  ucu gga ugaacacu   aug u
      ca  gu   u   c        aca   a 
Get sequence
Deep sequencing
581305 reads, 95 experiments
Comments

Mouse miR-125b was cloned from mouse brain tissues in [1]. There are 2 predicted hairpin precursor structures in the mouse genome, each has a closely related human homologue [2] (mir-125b-1, MI0000725 ; mir-125b-2, MI0000152 ; the latter was previously named mir-125b here).

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr16: 77646273-77646343 [+]
intergenic
Database links

Mature sequence mmu-miR-125b-5p

Accession MIMAT0000136
Previous IDs mmu-miR-125b
Sequence

7 - 

ucccugagacccuaacuuguga

 - 28

Get sequence
Deep sequencing 1120026 reads, 80 experiments
Evidence experimental; cloned [1,3-4], Solexa [5-6]
Validated targets
Predicted targets

Mature sequence mmu-miR-125b-2-3p

Accession MIMAT0004529
Previous IDs mmu-miR-125b*
Sequence

46 - 

acaagucagguucuugggaccu

 - 67

Get sequence
Deep sequencing 9743 reads, 56 experiments
Evidence experimental; cloned [4], Solexa [5-6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).