|
miRBase |
|
Stem-loop sequence mmu-mir-100 |
||||||
| Accession | MI0000692 | |||||
| Symbol | MGI:Mir100 | |||||
| Description | Mus musculus miR-100 stem-loop | |||||
| Gene family | MIPF0000025; mir-99 | |||||
| Stem-loop |
-uu c a cg uc a c au ccug g caca acc uaga cga cuugug ug u |||| | |||| ||| |||| ||| |||||| || ggau c gugu ugg aucu guu gaacac ac c ugu u a au gu c - gu |
|||||
| Deep sequencing |
| |||||
| Comments |
Mouse mir-100 is predicted [2] based on homology to a cloned miR from human (MI0000102 ) [1]. Its expression was later verified in mouse [3]. |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links | ||||||
Mature sequence mmu-miR-100-5p |
|
| Accession | MIMAT0000655 |
| Previous IDs | mmu-miR-100 |
| Sequence |
13 - aacccguagauccgaacuugug - 34 |
| Deep sequencing | 250301 reads, 82 experiments |
| Evidence | experimental; cloned [3], Solexa [4,6] |
| Predicted targets |
|
Mature sequence mmu-miR-100-3p |
|
| Accession | MIMAT0017051 |
| Previous IDs | mmu-miR-100* |
| Sequence |
47 - acaagcuugugucuauagguau - 68 |
| Deep sequencing | 467 reads, 37 experiments |
| Evidence | experimental; 454 [5], Solexa [6] |
| Predicted targets |
|
References |
|
| 1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
| 2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|