Stem-loop sequence kshv-mir-K12-11

Accession MI0002474
Description Kaposi sarcoma-associated herpesvirus miR-K12-11 stem-loop
Stem-loop
      u    u     c    a    ucu    -  gu 
5' cgc uugg cacag uuaa cauu   aggg cg  g
   ||| |||| ||||| |||| ||||   |||| ||   
3' gcg agcc guguc gauu guaa   uccu gu  u
      u    u     c    c    --u    a  au 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Samols et al. incorrectly named this sequence miR-6 [2]. Cai et al. define the likely miRNA primary transcripts in [3].

Genome context
Coordinates (EMBL:U75698.1) Overlapping transcripts
KSU75698: 120576-120646 [-]
intergenic
Clustered miRNAs
< 10kb from kshv-mir-K12-11
kshv-mir-K12-1 KSU75698: 121847-121913 [-]
kshv-miR-K12-2 KSU75698: 121674-121764 [-]
kshv-mir-K12-3 KSU75698: 121544-121613 [-]
kshv-mir-K12-4 KSU75698: 121413-121482 [-]
kshv-mir-K12-5 KSU75698: 121263-121332 [-]
kshv-mir-K12-6 KSU75698: 120761-120822 [-]
kshv-mir-K12-11 KSU75698: 120576-120646 [-]
kshv-mir-K12-7 KSU75698: 120355-120426 [-]
kshv-mir-K12-8 KSU75698: 119943-120012 [-]
kshv-mir-K12-9 KSU75698: 119300-119365 [-]
kshv-mir-K12-10a KSU75698: 117967-118036 [-]
kshv-mir-K12-12 KSU75698: 117674-117771 [-]

Mature sequence kshv-miR-K12-11-5p

Accession MIMAT0015213
Previous IDs kshv-miR-K12-11*
Sequence

7 - 

ggucacagcuuaaacauuucuagg

 - 30

Get sequence
Evidence experimental; Illumina [5], SOLiD [6]

Mature sequence kshv-miR-K12-11-3p

Accession MIMAT0002181
Previous IDs kshv-miR-K12-11
Sequence

46 - 

uuaaugcuuagccuguguccga

 - 67

Get sequence
Evidence experimental; cloned [1-2,4], Illumina [5], SOLiD [6]
Validated targets

References

1
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
2
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
6
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).