Stem-loop sequence kshv-mir-K12-1

AccessionMI0002475
DescriptionKaposi sarcoma-associated herpesvirus miR-K12-1 stem-loop
Stem-loop
-   ---  a        u      aa    uaca 
 cga   uu caggaaac gggugu  gcug    u
 |||   || |||||||| ||||||  ||||    a
 gcu   aa guccuuug uccacg  cggc    a
u   ccc  c        -      -a    cccu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Cai et al. define the likely miRNA primary transcripts in [4].

Genome context
Coordinates (EMBL:U75698.1) Overlapping transcripts
KSU75698: 121847-121913 [-]
intergenic
Clustered miRNAs
< 10kb from kshv-mir-K12-1
kshv-mir-K12-1KSU75698: 121847-121913 [-]
kshv-miR-K12-2KSU75698: 121674-121764 [-]
kshv-mir-K12-3KSU75698: 121544-121613 [-]
kshv-mir-K12-4KSU75698: 121413-121482 [-]
kshv-mir-K12-5KSU75698: 121263-121332 [-]
kshv-mir-K12-6KSU75698: 120761-120822 [-]
kshv-mir-K12-11KSU75698: 120576-120646 [-]
kshv-mir-K12-7KSU75698: 120355-120426 [-]
kshv-mir-K12-8KSU75698: 119943-120012 [-]
kshv-mir-K12-9KSU75698: 119300-119365 [-]
kshv-mir-K12-10aKSU75698: 117967-118036 [-]
kshv-mir-K12-12KSU75698: 117674-117771 [-]

Mature sequence kshv-miR-K12-1-5p

Accession MIMAT0002182
Previous IDskshv-miR-K12-1
Sequence

3 - 

auuacaggaaacuggguguaagc

 - 25

Get sequence
Evidence experimental; cloned [1-3,5], Illumina [6], SOLiD [7]
Validated targets

Mature sequence kshv-miR-K12-1-3p

Accession MIMAT0015214
Previous IDskshv-miR-K12-1*
Sequence

41 - 

gcagcaccuguuuccugcaacc

 - 62

Get sequence
Evidence experimental; Illumina [6], SOLiD [7]

References

1
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2
PMID:15782219 "Identification of microRNAs of the herpesvirus family" Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T Nat Methods. 2:269-276(2005).
3
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
7
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).