Stem-loop sequence hsa-mir-943

AccessionMI0005768 (change log)
Symbol HGNC:MIR943
DescriptionHomo sapiens miR-943 stem-loop
Gene family MIPF0000690; mir-943
Literature search

2 open access papers mention hsa-mir-943
(7 sentences)

Stem-loop
       c   -c    cuc    -         uuu  --      cu  ug 
5' ggga guu  ugag   gggg ugggggacg   gc  cgguca  gc  c
   |||| |||  ||||   |||| |||||||||   ||  ||||||  ||  u
3' cccu cgg  acuc   cccc accuccugc   cg  gucagu  cg  g
       a   aa    --a    g         ---  uu      cc  cg 
Get sequence
Deep sequencing
80 reads, 0 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 1986384-1986477 [-]
sense
OTTHUMT00000347676 ; NELFA-005; intron 4
OTTHUMT00000347675 ; NELFA-004; intron 7
OTTHUMT00000347673 ; NELFA-002; intron 7
OTTHUMT00000205240 ; NELFA-001; intron 8
OTTHUMT00000473007 ; NELFA-015; intron 8
OTTHUMT00000347674 ; NELFA-003; intron 8
ENST00000467661 ; NELFA-005; intron 4
ENST00000463820 ; NELFA-004; intron 7
ENST00000333877 ; NELFA-002; intron 7
ENST00000542778 ; NELFA-201; intron 7
ENST00000382882 ; NELFA-001; intron 8
ENST00000411638 ; NELFA-015; intron 8
ENST00000416258 ; NELFA-003; intron 8
Database links

Mature sequence hsa-miR-943

Accession MIMAT0004986
Sequence

55 - 

cugacuguugccguccuccag

 - 75

Get sequence
Deep sequencing70 reads, 41 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).