Stem-loop sequence hsa-mir-942

AccessionMI0005767 (change log)
Symbol HGNC:MIR942
DescriptionHomo sapiens miR-942 stem-loop
Gene family MIPF0000511; mir-942
Literature search

11 open access papers mention hsa-mir-942
(122 sentences)

Stem-loop
               u                       uacuca 
5' auuaggagagua cuucucuguuuuggccaugugug      c
   |||||||||||| |||||||||||||||||||||||       
3' uaauccuuucau gaagagacaaagccgguacacac      a
               u                       uccccg 
Get sequence
Deep sequencing
3611 reads, 2.74 reads per million, 146 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 117094643-117094728 [+]
antisense
OTTHUMT00000059036 ; CD58-001; intron 1
OTTHUMT00000387904 ; CD58-005; intron 1
OTTHUMT00000387905 ; CD58-004; intron 1
OTTHUMT00000059037 ; CD58-002; intron 1
ENST00000369489 ; CD58-001; intron 1
ENST00000464088 ; CD58-005; intron 1
ENST00000457047 ; CD58-004; intron 1
ENST00000369487 ; CD58-002; intron 1
Database links

Mature sequence hsa-miR-942-5p

Accession MIMAT0004985
Sequence

13 - 

ucuucucuguuuuggccaugug

 - 34

Get sequence
Deep sequencing2644 reads, 142 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-942-3p

Accession MIMAT0026734
Sequence

53 - 

cacauggccgaaacagagaagu

 - 74

Get sequence
Deep sequencing954 reads, 70 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).