Stem-loop sequence hsa-mir-941-1

AccessionMI0005763 (change log)
Symbol HGNC:MIR941-1
DescriptionHomo sapiens miR-941-1 stem-loop
Gene family MIPF0000387; mir-941
Literature search

11 open access papers mention hsa-mir-941-1
(52 sentences)

Stem-loop
   u u  -        c  g    c   aca   -  a g 
5'  g gg acaugugc ca ggcc ggg   gcg cc c g
    | || |||||||| || |||| |||   ||| || |  
3'  c cc uguacacg gu ucgg ccc   cgc gg g a
   a -  g        u  g    -   --a   a  a a 
Get sequence
Deep sequencing
18131 reads, 57.2 reads per million, 145 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 63919449-63919520 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-941-1
hsa-mir-941-1chr20: 63919449-63919520 [+]
hsa-mir-941-2chr20: 63919505-63919576 [+]
hsa-mir-941-3chr20: 63919561-63919632 [+]
hsa-mir-941-4chr20: 63919756-63919827 [+]
hsa-mir-941-5chr20: 63919868-63919939 [+]
Database links

Mature sequence hsa-miR-941

Accession MIMAT0004984
Sequence

47 - 

cacccggcugugugcacaugugc

 - 69

Get sequence
Deep sequencing87795 reads, 144 experiments
Evidence experimental; cloned [1], SOLiD [2]

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
2
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).