Stem-loop sequence hsa-mir-938

AccessionMI0005760 (change log)
Symbol HGNC:MIR938
DescriptionHomo sapiens miR-938 stem-loop
Gene family MIPF0000469; mir-938
Literature search

3 open access papers mention hsa-mir-938
(4 sentences)

Stem-loop
               u  gcc          a   - a  g  cc 
5' gaagguguacca gu   cuuaaaggug acc c gu ca  u
   |||||||||||| ||   |||||||||| ||| | || ||   
3' cuuccguauggu ca   gaauuuccac ugg g ca gu  u
               u  --a          a   u c  a  ac 
Get sequence
Deep sequencing
23 reads, 53.8 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 29602264-29602346 [-]
antisense
OTTHUMT00000047382 ; LYZL1-002; intron 3
ENST00000494304 ; LYZL1-002; intron 3
Database links

Mature sequence hsa-miR-938

Accession MIMAT0004981
Sequence

15 - 

ugcccuuaaaggugaacccagu

 - 36

Get sequence
Deep sequencing19 reads, 11 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).