Stem-loop sequence hsa-mir-937

AccessionMI0005759 (change log)
Symbol HGNC:MIR937
DescriptionHomo sapiens miR-937 stem-loop
Gene family MIPF0000560; mir-937
Literature search

7 open access papers mention hsa-mir-937
(12 sentences)

Stem-loop
      -a    ----ccc   u           g  c   cccccu  u 
5' agc  cugc       cgg gagucagggug gg ugg      gc u
   |||  ||||       ||| ||||||||||| || |||      || c
3' ucg  gacg       guc cucagucucgc cc acc      cg g
      ag    uccaccc   u           g  u   ------  u 
Get sequence
Deep sequencing
224 reads, 18.4 reads per million, 87 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 143812957-143813042 [-]
antisense
OTTHUMT00000379706 ; THEM6-001; intron 1
OTTHUMT00000379710 ; THEM6-006; intron 1
ENST00000336138 ; THEM6-001; intron 1
ENST00000520217 ; THEM6-006; intron 1
Database links

Mature sequence hsa-miR-937-5p

Accession MIMAT0022938
Sequence

14 - 

gugagucaggguggggcugg

 - 33

Get sequence
Deep sequencing38 reads, 20 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-937-3p

Accession MIMAT0004980
Previous IDshsa-miR-937
Sequence

51 - 

auccgcgcucugacucucugcc

 - 72

Get sequence
Deep sequencing169 reads, 71 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).