Stem-loop sequence hsa-mir-936

AccessionMI0005758 (change log)
Symbol HGNC:MIR936
DescriptionHomo sapiens miR-936 stem-loop
Gene family MIPF0000517; mir-936
Literature search

5 open access papers mention hsa-mir-936
(5 sentences)

Stem-loop
   ucaa     cu     -------        -    aa  g   -aaa  a u 
5'     ggcca  gggac       aguagagg gagg  uc cag    uc c c
       |||||  |||||       |||||||| ||||  || |||    || |  
3'     ccggu  uccug       ucaucuuc uucc  ag guc    ag g c
   agac     cg     gaccauu        g    ag  a   aacg  - a 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 104048089-104048186 [-]
antisense
OTTHUMT00000050051 ; GBF1-001; intron 3
ENST00000369983 ; GBF1-001; intron 3
Database links

Mature sequence hsa-miR-936

Accession MIMAT0004979
Sequence

15 - 

acaguagagggaggaaucgcag

 - 36

Get sequence
Deep sequencing10 reads, 8 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).