Stem-loop sequence hsa-mir-935

AccessionMI0005757 (change log)
Symbol HGNC:MIR935
DescriptionHomo sapiens miR-935 stem-loop
Gene family MIPF0000606; mir-935
Literature search

10 open access papers mention hsa-mir-935
(34 sentences)

Stem-loop
            gcg      a             ccc  c   caucc 
5' ggcgggggc   ggcggc guggcgggagcgg   cu ggc     u
   |||||||||   |||||| |||||||||||||   || |||      
3' ucgcccucg   ccgccg caucgccuucgcc   ga ccg     c
            ---      c             auu  c   ucugc 
Get sequence
Deep sequencing
6540 reads, 11.8 reads per million, 110 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53982307-53982397 [+]
sense
OTTHUMT00000350639 ; ZNF813-002; intron 1
OTTHUMT00000350638 ; ZNF813-001; intron 1
OTTHUMT00000350640 ; ZNF813-003; intron 1
ENST00000468450 ; ZNF813-002; intron 1
ENST00000396403 ; ZNF813-001; intron 1
ENST00000490956 ; ZNF813-003; intron 1
ENST00000396421 ; ZNF813-201; intron 1
Database links

Mature sequence hsa-miR-935

Accession MIMAT0004978
Sequence

56 - 

ccaguuaccgcuuccgcuaccgc

 - 78

Get sequence
Deep sequencing6467 reads, 103 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).