Stem-loop sequence hsa-mir-924

AccessionMI0005716 (change log)
Symbol HGNC:MIR924
DescriptionHomo sapiens miR-924 stem-loop
Gene family MIPF0000513; mir-924
Literature search

1 open access papers mention hsa-mir-924
(3 sentences)

Stem-loop
   --aa    g   ----  u    -    g 
5'     uaga ucu    ug gaug ucuu c
       |||| |||    || |||| |||| u
3'     aucu aga    ac cuac ggga u
   caac    g   ucca  -    c    a 
Get sequence
Deep sequencing
3 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 39622123-39622175 [-]
antisense
OTTHUMT00000441506 ; PIK3C3-005; intron 3
OTTHUMT00000441662 ; PIK3C3-012; intron 3
OTTHUMT00000461291 ; PIK3C3-019; intron 4
OTTHUMT00000441504 ; PIK3C3-004; intron 6
OTTHUMT00000441498 ; PIK3C3-002; intron 18
OTTHUMT00000255804 ; PIK3C3-001; intron 19
ENST00000589056 ; PIK3C3-005; intron 3
ENST00000587402 ; PIK3C3-012; intron 3
ENST00000597477 ; PIK3C3-019; intron 4
ENST00000593098 ; PIK3C3-004; intron 6
ENST00000398870 ; PIK3C3-002; intron 18
ENST00000262039 ; PIK3C3-001; intron 19
Database links

Mature sequence hsa-miR-924

Accession MIMAT0004974
Sequence

4 - 

agagucuugugaugucuugc

 - 23

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17573847 "Analysis of gene expression in normal and neoplastic human testis: new roles of RNA" Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E, Leffers H Int J Androl. 30:316-326(2007).