Stem-loop sequence hsa-mir-891b

AccessionMI0005534 (change log)
Symbol HGNC:MIR891B
DescriptionHomo sapiens miR-891b stem-loop
Gene family MIPF0000420; mir-891
Literature search

6 open access papers mention hsa-mir-891b
(25 sentences)

Stem-loop
   c   --a     u     uu  c  a        uucag 
5'  cuu   auccu gcaac  ac ug gucauuga     u
    |||   ||||| |||||  || || ||||||||     a
3'  gaa   uggga uguug  ug ac cgguaacu     a
   a   aac     u     uu  u  a        uacaa 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 146001053-146001131 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-891b
hsa-mir-891bchrX: 146001053-146001131 [-]
hsa-mir-892bchrX: 145997198-145997274 [-]
hsa-mir-892achrX: 145996669-145996743 [-]
hsa-mir-888chrX: 145994784-145994860 [-]
hsa-mir-890chrX: 145994275-145994351 [-]
hsa-mir-892cchrX: 145992750-145992826 [-]
Database links

Mature sequence hsa-miR-891b

Accession MIMAT0004913
Sequence

11 - 

ugcaacuuaccugagucauuga

 - 32

Get sequence
Deep sequencing54 reads, 29 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).