Stem-loop sequence hsa-mir-8485

AccessionMI0027288 (change log)
Symbol HGNC:MIR8485
DescriptionHomo sapiens miR-8485 stem-loop
Literature search

1 open access papers mention hsa-mir-8485
(1 sentences)

Stem-loop
   ucugugau                    -auauagcaua     auaca 
5'         auacgugugugugugugugu           ugugu     u
           ||||||||||||||||||||           |||||      
3'         uaugcacacacacacacaca           acaca     a
   --------                    cacacacacac     cacac 
Get sequence
Deep sequencing
4232 reads, 1e+03 reads per million, 169 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 50696172-50696262 [-]
sense
OTTHUMT00000325295 ; NRXN1-015; intron 2
OTTHUMT00000323980 ; NRXN1-006; intron 10
OTTHUMT00000325293 ; NRXN1-010; intron 15
OTTHUMT00000325291 ; NRXN1-001; intron 16
OTTHUMT00000325104 ; NRXN1-003; intron 16
OTTHUMT00000323894 ; NRXN1-002; intron 17
ENST00000401710 ; NRXN1-015; intron 2
ENST00000331040 ; NRXN1-006; intron 10
ENST00000405472 ; NRXN1-010; intron 15
ENST00000406316 ; NRXN1-001; intron 16
ENST00000401669 ; NRXN1-003; intron 16
ENST00000402717 ; NRXN1-201; intron 16
ENST00000404971 ; NRXN1-002; intron 17
ENST00000406859 ; NRXN1-202; intron 17
Database links

Mature sequence hsa-miR-8485

Accession MIMAT0033692
Sequence

71 - 

cacacacacacacacacguau

 - 91

Get sequence
Deep sequencing1623 reads, 135 experiments
Evidence experimental; RT-PCR [1]
Database links
Predicted targets

References

1