Stem-loop sequence hsa-mir-8089

AccessionMI0025925 (change log)
Symbol HGNC:MIR8089
DescriptionHomo sapiens miR-8089 stem-loop
Literature search

1 open access papers mention hsa-mir-8089
(7 sentences)

Stem-loop
   aa      -  ca        u     ga  g   gc   cu 
5'   ggagca cu  cuccaauu cccug  cu ggg  agg  g
     |||||| ||  |||||||| |||||  || |||  |||   
3'   ccuugu gg  gggguuag gggac  gg ucc  ucc  c
   ga      a  ac        -     ag  g   --   ac 
Get sequence
Deep sequencing
21 reads, 28.6 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 181043403-181043484 [-]
intergenic
Database links

Mature sequence hsa-miR-8089

Accession MIMAT0031016
Sequence

49 - 

ccuggggacaggggauuggggcag

 - 72

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).