Stem-loop sequence hsa-mir-8088

AccessionMI0025924 (change log)
Symbol HGNC:MIR8088
DescriptionHomo sapiens miR-8088 stem-loop
Stem-loop
   -   ag   -    u    a    a      uauggauuc      u 
5'  ggg  gag ggcc cggu cugg aagggg         uguugu u
    |||  ||| |||| |||| |||| ||||||         ||||||  
3'  cuc  cuc cugg guca ggcu uucuuc         acaacg u
   a   ga   a    -    c    a      -------uu      g 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 52336557-52336642 [-]
intergenic
Database links

Mature sequence hsa-miR-8088

Accession MIMAT0031015
Sequence

11 - 

ccucgguacuggaaaggggua

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).