Stem-loop sequence hsa-mir-8087

AccessionMI0025923 (change log)
Symbol HGNC:MIR8087
DescriptionHomo sapiens miR-8087 stem-loop
Literature search

1 open access papers mention hsa-mir-8087
(1 sentences)

Stem-loop
   ucua     u          ug    ac         ac 
5'     agaag gaagacuucu  gauu  aggggcccu  u
       ||||| ||||||||||  ||||  |||||||||   
3'     ucuuu cuuuugaagg  uuga  uucccggga  u
   uccg     c          --    cu         au 
Get sequence
Deep sequencing
313 reads, 65.6 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 27514970-27515047 [-]
intergenic
Database links

Mature sequence hsa-miR-8087

Accession MIMAT0031014
Sequence

11 - 

gaagacuucuuggauuacagggg

 - 33

Get sequence
Deep sequencing13 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).