Stem-loop sequence hsa-mir-8086

AccessionMI0025922 (change log)
Symbol HGNC:MIR8086
DescriptionHomo sapiens miR-8086 stem-loop
Stem-loop
   u     a  -  g         a u    u      -   uu    uu 
5'  ccacu gu cu cuagucugg c gaua gguuag cuu  uuuu  u
    ||||| || || ||||||||| | |||| |||||| |||  ||||   
3'  gguga ca ga ggucggacc g uugu ucgguc gag  agag  u
   c     -  u  -         c -    c      u   gu    uu 
Get sequence
Deep sequencing
11043 reads, 209 reads per million, 170 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 28289258-28289350 [-]
antisense
OTTHUMT00000047338 ; RP11-218D6.4-001; intron 1
ENST00000425137 ; RP11-218D6.4-001; intron 1
Database links

Mature sequence hsa-miR-8086

Accession MIMAT0031013
Sequence

11 - 

ugcuagucuggacugauauggu

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).