Stem-loop sequence hsa-mir-8085

AccessionMI0025921 (change log)
Symbol HGNC:MIR8085
DescriptionHomo sapiens miR-8085 stem-loop
Stem-loop
   c       g     aga ag      -   g  u 
5'  uaggagg auggg   g  gacugu gag ca g
    ||||||| |||||   |  |||||| ||| ||  
3'  auccuuc uaccc   c  cuggua cuc gu g
   c       -     --g -a      u   g  g 
Get sequence
Deep sequencing
51 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 44758657-44758721 [+]
sense
ENST00000334152 ; ZNF233-201; intron 1
antisense
OTTHUMT00000460728 ; ZNF235-006; intron 3
OTTHUMT00000460729 ; ZNF235-005; intron 4
ENST00000592844 ; ZNF235-006; intron 3
ENST00000589799 ; ZNF235-005; intron 4
Database links

Mature sequence hsa-miR-8085

Accession MIMAT0031012
Sequence

11 - 

ugggagagaggacugugaggc

 - 31

Get sequence
Deep sequencing26 reads, 20 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).