Stem-loop sequence hsa-mir-8084

AccessionMI0025920 (change log)
Symbol HGNC:MIR8084
DescriptionHomo sapiens miR-8084 stem-loop
Stem-loop
   -     aaa    aua     u     --a       g  -uu    u 
5'  cagau   uaga   cuaag aaaaa   ucaguau ga   aaau u
    |||||   ||||   ||||| |||||   ||||||| ||   ||||  
3'  guuug   auuu   gauuc uuuuu   agucaua cu   uuua a
   g     ---    --g     u     aug       g  ccu    u 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 93029751-93029839 [+]
antisense
OTTHUMT00000377043 ; RUNX1T1-002; intron 1
OTTHUMT00000377117 ; RUNX1T1-009; intron 1
OTTHUMT00000377044 ; RUNX1T1-004; 5'UTR (exon 1)
OTTHUMT00000377118 ; RUNX1T1-011; intron 1
OTTHUMT00000377122 ; RUNX1T1-013; intron 1
OTTHUMT00000377346 ; RUNX1T1-040; intron 1
OTTHUMT00000377047 ; RUNX1T1-005; intron 1
OTTHUMT00000377348 ; RUNX1T1-038; intron 1
OTTHUMT00000377352 ; RUNX1T1-041; intron 1
OTTHUMT00000377123 ; RUNX1T1-012; intron 1
OTTHUMT00000377045 ; RUNX1T1-001; intron 2
OTTHUMT00000377506 ; RUNX1T1-042; intron 2
OTTHUMT00000377350 ; RUNX1T1-019; intron 2
OTTHUMT00000377351 ; RUNX1T1-039; intron 2
OTTHUMT00000377353 ; RUNX1T1-032; intron 2
OTTHUMT00000377354 ; RUNX1T1-025; intron 2
OTTHUMT00000377355 ; RUNX1T1-016; intron 2
OTTHUMT00000377358 ; RUNX1T1-027; intron 2
OTTHUMT00000377359 ; RUNX1T1-033; intron 2
OTTHUMT00000377360 ; RUNX1T1-031; intron 2
OTTHUMT00000377366 ; RUNX1T1-035; intron 2
OTTHUMT00000377347 ; RUNX1T1-018; intron 3
OTTHUMT00000377349 ; RUNX1T1-017; intron 3
OTTHUMT00000377356 ; RUNX1T1-015; intron 3
OTTHUMT00000377357 ; RUNX1T1-029; intron 3
OTTHUMT00000377361 ; RUNX1T1-022; intron 3
OTTHUMT00000377362 ; RUNX1T1-014; intron 3
OTTHUMT00000377363 ; RUNX1T1-020; intron 3
OTTHUMT00000377364 ; RUNX1T1-036; intron 3
OTTHUMT00000377368 ; RUNX1T1-023; intron 3
OTTHUMT00000377369 ; RUNX1T1-037; intron 3
OTTHUMT00000377370 ; RUNX1T1-034; intron 3
OTTHUMT00000377048 ; RUNX1T1-003; intron 3
OTTHUMT00000377371 ; RUNX1T1-024; intron 3
OTTHUMT00000377365 ; RUNX1T1-026; intron 4
OTTHUMT00000377367 ; RUNX1T1-028; intron 4
OTTHUMT00000377372 ; RUNX1T1-021; intron 4
OTTHUMT00000377119 ; RUNX1T1-010; intron 5
ENST00000396218 ; RUNX1T1-002; intron 1
ENST00000360348 ; RUNX1T1-009; intron 1
ENST00000422361 ; RUNX1T1-004; 5'UTR (exon 1)
ENST00000520724 ; RUNX1T1-011; intron 1
ENST00000522316 ; RUNX1T1-013; intron 1
ENST00000521054 ; RUNX1T1-040; intron 1
ENST00000523290 ; RUNX1T1-005; intron 1
ENST00000517792 ; RUNX1T1-038; intron 1
ENST00000520556 ; RUNX1T1-041; intron 1
ENST00000518832 ; RUNX1T1-012; intron 1
ENST00000436581 ; RUNX1T1-202; intron 1
ENST00000265814 ; RUNX1T1-201; intron 1
ENST00000523629 ; RUNX1T1-001; intron 2
ENST00000518992 ; RUNX1T1-042; intron 2
ENST00000517919 ; RUNX1T1-019; intron 2
ENST00000521733 ; RUNX1T1-039; intron 2
ENST00000521319 ; RUNX1T1-032; intron 2
ENST00000520583 ; RUNX1T1-025; intron 2
ENST00000523168 ; RUNX1T1-016; intron 2
ENST00000521897 ; RUNX1T1-027; intron 2
ENST00000518317 ; RUNX1T1-033; intron 2
ENST00000521375 ; RUNX1T1-031; intron 2
ENST00000522065 ; RUNX1T1-035; intron 2
ENST00000519847 ; RUNX1T1-018; intron 3
ENST00000522467 ; RUNX1T1-017; intron 3
ENST00000519577 ; RUNX1T1-015; intron 3
ENST00000518823 ; RUNX1T1-029; intron 3
ENST00000519422 ; RUNX1T1-022; intron 3
ENST00000524215 ; RUNX1T1-014; intron 3
ENST00000520974 ; RUNX1T1-020; intron 3
ENST00000520172 ; RUNX1T1-036; intron 3
ENST00000519061 ; RUNX1T1-023; intron 3
ENST00000518256 ; RUNX1T1-037; intron 3
ENST00000520428 ; RUNX1T1-034; intron 3
ENST00000522163 ; RUNX1T1-003; intron 3
ENST00000521902 ; RUNX1T1-024; intron 3
ENST00000517493 ; RUNX1T1-026; intron 4
ENST00000518954 ; RUNX1T1-028; intron 4
ENST00000522860 ; RUNX1T1-021; intron 4
ENST00000518844 ; RUNX1T1-010; intron 5
Database links

Mature sequence hsa-miR-8084

Accession MIMAT0031011
Sequence

11 - 

gaauacuaaguaaaaaaucagua

 - 33

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).