Stem-loop sequence hsa-mir-8083

AccessionMI0025919 (change log)
Symbol HGNC:MIR8083
DescriptionHomo sapiens miR-8083 stem-loop
Stem-loop
   c  -            cu     ---      a   -  c   c  c 
5'  ga gggggugcagga  ugacg   gcugca cug ug ggc gg c
    || ||||||||||||  |||||   |||||| ||| || ||| || a
3'  cu cucccaugucuu  acugu   cgacgu ggc ac cug cc c
   u  a            --     cug      g   c  a   -  a 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 153689705-153689793 [-]
sense
OTTHUMT00000090044 ; RP11-216N14.1-001; exon 2
ENST00000454246 ; RP11-216N14.1-001; exon 2
Database links

Mature sequence hsa-miR-8083

Accession MIMAT0031010
Sequence

11 - 

caggacuugacggcugcaacu

 - 31

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).