Stem-loop sequence hsa-mir-8082

AccessionMI0025918 (change log)
Symbol HGNC:MIR8082
DescriptionHomo sapiens miR-8082 stem-loop
Stem-loop
   gc       au  u     ugg      -u   gg     a 
5'   cugugug  ga ggagc   gaauac  cug  gagag g
     |||||||  || |||||   ||||||  |||  |||||  
3'   gacacac  uu cuucg   uuuaug  gac  uucuc u
   ca       cc  c     --u      uc   uu     c 
Get sequence
Deep sequencing
22 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 113152282-113152362 [+]
antisense
OTTHUMT00000431753 ; RP11-73K9.2-001; exon 1
ENST00000562919 ; RP11-73K9.2-001; exon 1
Database links

Mature sequence hsa-miR-8082

Accession MIMAT0031009
Sequence

11 - 

ugauggagcugggaauacucug

 - 32

Get sequence
Deep sequencing7 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).