Stem-loop sequence hsa-mir-8081

AccessionMI0025917 (change log)
Symbol HGNC:MIR8081
DescriptionHomo sapiens miR-8081 stem-loop
Stem-loop
   u     u        ucu   u u  c   -ua     ccc  ccuc 
5'  uauug cuuuauuu   gag c ug cuc   uggcc   cu    u
    ||||| ||||||||   ||| | || |||   |||||   ||     
3'  guaac gaaguaag   uuc g gc gag   accgg   ga    c
   u     u        ucu   c u  u   uuc     aac  aagu 
Get sequence
Deep sequencing
63 reads, 472 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 106600928-106601022 [+]
intergenic
Database links

Mature sequence hsa-miR-8081

Accession MIMAT0031008
Sequence

63 - 

cuugagucgugccuuucugaaug

 - 85

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).