Stem-loop sequence hsa-mir-8080

AccessionMI0025916 (change log)
Symbol HGNC:MIR8080
DescriptionHomo sapiens miR-8080 stem-loop
Stem-loop
   auggc     -ga      cu      -aa   -  gag      g 
5'      ucuaa   aggaca  gguguc   cgg cu   cccuuu a
        |||||   ||||||  ||||||   ||| ||   ||||||  
3'      ggguu   uccugu  ucacag   guu gg   ggggga u
   guaaa     agg      au      aag   u  --a      a 
Get sequence
Deep sequencing
16 reads, 15.4 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 79866495-79866583 [-]
antisense
OTTHUMT00000328514 ; CTNNA2-001; intron 1
OTTHUMT00000328513 ; CTNNA2-005; intron 1
OTTHUMT00000328531 ; CTNNA2-006; intron 2
OTTHUMT00000328532 ; CTNNA2-007; intron 2
OTTHUMT00000328510 ; CTNNA2-002; intron 5
ENST00000496558 ; CTNNA2-001; intron 1
ENST00000409266 ; CTNNA2-005; intron 1
ENST00000361291 ; CTNNA2-201; intron 1
ENST00000451966 ; CTNNA2-006; intron 2
ENST00000409971 ; CTNNA2-007; intron 2
ENST00000466387 ; CTNNA2-002; intron 5
Database links

Mature sequence hsa-miR-8080

Accession MIMAT0031007
Sequence

11 - 

gaaggacacuggugucaacggcu

 - 33

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).