Stem-loop sequence hsa-mir-8079

AccessionMI0025915 (change log)
Symbol HGNC:MIR8079
DescriptionHomo sapiens miR-8079 stem-loop
Stem-loop
   ugc    - uu a     c      g        ag 
5'    cugg g  c gugau gucucu cuggcugu  g
      |||| |  | ||||| |||||| ||||||||   
3'    gacc c  g cacua cagggg gacugacg  g
   gga    u cg a     -      a        ac 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 44196129-44196200 [-]
sense
OTTHUMT00000044717 ; ENOX1-001; intron 2
ENST00000261488 ; ENOX1-001; intron 2
Database links

Mature sequence hsa-miR-8079

Accession MIMAT0031006
Sequence

11 - 

cagugaucgucucugcuggc

 - 30

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).