Stem-loop sequence hsa-mir-8078

AccessionMI0025914 (change log)
Symbol HGNC:MIR8078
DescriptionHomo sapiens miR-8078 stem-loop
Literature search

1 open access papers mention hsa-mir-8078
(1 sentences)

Stem-loop
   u    --cccgcccc   -         gacc         uuc 
5'  ccgc          cuc caccgggcu    ggccuggga   c
    ||||          ||| |||||||||    |||||||||    
3'  ggcg          gag guggcccgg    cuggaucuu   u
   -    acacaccuca   a         --au         ccg 
Get sequence
Deep sequencing
122 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 112256-112339 [-]
antisense
OTTHUMT00000472417 ; ROCK1P1-003; intron 1
ENST00000608049 ; ROCK1P1-003; intron 1
Database links

Mature sequence hsa-miR-8078

Accession MIMAT0031005
Sequence

52 - 

ggucuaggcccggugagagacuc

 - 74

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).