Stem-loop sequence hsa-mir-8077

AccessionMI0025913 (change log)
Symbol HGNC:MIR8077
DescriptionHomo sapiens miR-8077 stem-loop
Stem-loop
   gug         -  g   uggg    ggg     aaa 
5'    gggcagggg gu gga    cacu   agucc   g
      ||||||||| || |||    ||||   |||||    
3'    cccgucucc ca ucu    guga   ucggg   g
   caa         u  g   uggg    --g     aaa 
Get sequence
Deep sequencing
22 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 42351131-42351205 [+]
sense
OTTHUMT00000463041 ; DMRTC2-002; intron 1
OTTHUMT00000463042 ; DMRTC2-004; intron 1
OTTHUMT00000463043 ; DMRTC2-003; intron 1
OTTHUMT00000463044 ; DMRTC2-005; intron 1
OTTHUMT00000463045 ; DMRTC2-001; intron 1
OTTHUMT00000463047 ; DMRTC2-007; intron 1
OTTHUMT00000463046 ; DMRTC2-006; intron 2
ENST00000601660 ; DMRTC2-002; intron 1
ENST00000600017 ; DMRTC2-004; intron 1
ENST00000596827 ; DMRTC2-003; intron 1
ENST00000602098 ; DMRTC2-005; intron 1
ENST00000269945 ; DMRTC2-001; intron 1
ENST00000596660 ; DMRTC2-007; intron 1
ENST00000596258 ; DMRTC2-006; intron 2
Database links

Mature sequence hsa-miR-8077

Accession MIMAT0031004
Sequence

44 - 

ggcugagugggguucugacucc

 - 65

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).