Stem-loop sequence hsa-mir-8076

AccessionMI0025912 (change log)
Symbol HGNC:MIR8076
DescriptionHomo sapiens miR-8076 stem-loop
Stem-loop
   c  a     -    cug   u    uuc   -       g  a 
5'  cu uccac acgu   guc agag   ucc ugugaga cu c
    || ||||| ||||   ||| ||||   ||| ||||||| ||  
3'  ga aggug ugua   uag ucuu   agg auauucu ga u
   -  a     a    aca   -    uuc   u       -  a 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 113432118-113432200 [-]
intergenic
Database links

Mature sequence hsa-miR-8076

Accession MIMAT0031003
Sequence

50 - 

uauauggacuuuucugauacaaug

 - 73

Get sequence
Deep sequencing20 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).