Stem-loop sequence hsa-mir-8075

AccessionMI0025911 (change log)
Symbol HGNC:MIR8075
DescriptionHomo sapiens miR-8075 stem-loop
Stem-loop
   ccuu  u  u       g    -       -  -  uuauac 
5'     gc ga ggcagau ucgg aucugcc uc gc      g
       || || ||||||| |||| ||||||| || ||       
3'     cg cu ccgucug ggcu uagacgg ag cg      u
   uauu  -  -       -    g       u  u  uucccg 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 113262920-113262999 [+]
intergenic
Database links

Mature sequence hsa-miR-8075

Accession MIMAT0031002
Sequence

47 - 

ugcugauggcagaugucgggucug

 - 70

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).