Stem-loop sequence hsa-mir-8074

AccessionMI0025910 (change log)
Symbol HGNC:MIR8074
DescriptionHomo sapiens miR-8074 stem-loop
Literature search

1 open access papers mention hsa-mir-8074
(1 sentences)

Stem-loop
   c     -cc     u     a  aug -        - ccc 
5'  caguu   ugagu uaugc ag   c ccauggga g   a
    |||||   ||||| ||||| ||   | |||||||| |    
3'  gucaa   acuca guacg uc   g gguauccu c   g
   a     cac     u     g  aga c        g aga 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 51206929-51207009 [-]
sense
OTTHUMT00000268075 ; SHANK1-005; exon 2
OTTHUMT00000268071 ; SHANK1-001; exon 10
OTTHUMT00000465240 ; SHANK1-008; exon 10
OTTHUMT00000268072 ; SHANK1-002; exon 11
ENST00000461154 ; SHANK1-005; exon 2
ENST00000293441 ; SHANK1-001; exon 10
ENST00000359082 ; SHANK1-008; exon 10
ENST00000391814 ; SHANK1-002; exon 11
Database links

Mature sequence hsa-miR-8074

Accession MIMAT0031001
Sequence

48 - 

cuauggcgagacuggcauguacuc

 - 71

Get sequence
Deep sequencing9 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).